ID: 922779980_922779989

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 922779980 922779989
Species Human (GRCh38) Human (GRCh38)
Location 1:228244386-228244408 1:228244430-228244452
Sequence CCCAGGCCCAGACGGAGGTGACG CTGAGCTCCAGCTCAAAAGTGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 4, 3: 12, 4: 98} {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!