ID: 922779983_922779989

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 922779983 922779989
Species Human (GRCh38) Human (GRCh38)
Location 1:228244392-228244414 1:228244430-228244452
Sequence CCCAGACGGAGGTGACGTGGTAC CTGAGCTCCAGCTCAAAAGTGGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 2, 3: 3, 4: 77} {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!