ID: 922782441_922782448

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 922782441 922782448
Species Human (GRCh38) Human (GRCh38)
Location 1:228263896-228263918 1:228263936-228263958
Sequence CCTGCCTGGGGCAGCCCTTGGTG AGAAACTGTGTTCCTTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 85, 4: 428} {0: 1, 1: 1, 2: 2, 3: 17, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!