ID: 922791526_922791538

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 922791526 922791538
Species Human (GRCh38) Human (GRCh38)
Location 1:228313827-228313849 1:228313871-228313893
Sequence CCGGCACTGTCATCTTCCGCGCA AAGTTGTTGATCAAAGGTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64} {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!