ID: 922791908_922791914

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 922791908 922791914
Species Human (GRCh38) Human (GRCh38)
Location 1:228315594-228315616 1:228315625-228315647
Sequence CCTGTGAGGTTTCTCACCTGTGA GCCCAGTGCCAAAGTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178} {0: 1, 1: 0, 2: 0, 3: 15, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!