ID: 922794315_922794323

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922794315 922794323
Species Human (GRCh38) Human (GRCh38)
Location 1:228332530-228332552 1:228332569-228332591
Sequence CCCATTATTCCCTAGTAGGATGG CACTATCACTGTTTCTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} {0: 1, 1: 0, 2: 0, 3: 22, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!