ID: 922797004_922797010

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 922797004 922797010
Species Human (GRCh38) Human (GRCh38)
Location 1:228345202-228345224 1:228345232-228345254
Sequence CCAGTTCAGTCCTTATAACCGAG CTGGTGTTGCAGGCACCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 34} {0: 1, 1: 0, 2: 3, 3: 88, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!