ID: 922798302_922798306

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922798302 922798306
Species Human (GRCh38) Human (GRCh38)
Location 1:228352361-228352383 1:228352398-228352420
Sequence CCAAAGCTAGGTGCTGTGGCTCA ACAATTTGGGAAGCCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 78, 3: 986, 4: 3740} {0: 9, 1: 500, 2: 10255, 3: 87238, 4: 208824}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!