ID: 922800347_922800361

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 922800347 922800361
Species Human (GRCh38) Human (GRCh38)
Location 1:228362148-228362170 1:228362198-228362220
Sequence CCAAGCTTCCTCTGGTTCTCACC GGAGAGGCCAGCCCTGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 318} {0: 1, 1: 0, 2: 6, 3: 75, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!