ID: 922821272_922821285

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 922821272 922821285
Species Human (GRCh38) Human (GRCh38)
Location 1:228487425-228487447 1:228487470-228487492
Sequence CCGTCTAGGTCTCCGGCCCTCCC GGCCCCGCCGCCCGCAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 188} {0: 1, 1: 1, 2: 17, 3: 111, 4: 691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!