ID: 922821409_922821415

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 922821409 922821415
Species Human (GRCh38) Human (GRCh38)
Location 1:228487925-228487947 1:228487938-228487960
Sequence CCTCTCCGCCCCCGCCCCGGTCC GCCCCGGTCCCCCTGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 21, 3: 208, 4: 1388} {0: 1, 1: 0, 2: 1, 3: 35, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!