ID: 922825661_922825664 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 922825661 | 922825664 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:228516372-228516394 | 1:228516400-228516422 |
| Sequence | CCTTTGCCCATTTTTAAATGGAG | TTTAGCTTGTTGAATTGTTTAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 7, 2: 34, 3: 67, 4: 500} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||