ID: 922832738_922832751

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 922832738 922832751
Species Human (GRCh38) Human (GRCh38)
Location 1:228611821-228611843 1:228611868-228611890
Sequence CCTTCCCCCGGTTTGGAAGGGTG TTGAATCGCCTGGGCGTTCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!