ID: 922834342_922834360

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 922834342 922834360
Species Human (GRCh38) Human (GRCh38)
Location 1:228618290-228618312 1:228618336-228618358
Sequence CCGAGATTTGCAGAGCGCGCCCG CCGGGCGGGCCCGGAGGCCTGGG
Strand - +
Off-target summary {0: 18, 1: 1, 2: 0, 3: 8, 4: 39} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!