ID: 922834897_922834905

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 922834897 922834905
Species Human (GRCh38) Human (GRCh38)
Location 1:228620492-228620514 1:228620530-228620552
Sequence CCTGTGCTCTGGGTGCCTTGCGG GCAGAGCGCGCCCGCCCGTTTGG
Strand - +
Off-target summary No data {0: 18, 1: 0, 2: 2, 3: 2, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!