ID: 922835527_922835541

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 922835527 922835541
Species Human (GRCh38) Human (GRCh38)
Location 1:228622979-228623001 1:228623031-228623053
Sequence CCTTCCCCCGGTTTGGAAGGGTG TCGCCTGGGCGTTCCGGGAGCGG
Strand - +
Off-target summary No data {0: 16, 1: 2, 2: 0, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!