ID: 922836085_922836095

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922836085 922836095
Species Human (GRCh38) Human (GRCh38)
Location 1:228625221-228625243 1:228625258-228625280
Sequence CCTTCCCCCGGTTTGGAAGGGTG GATGGGTGAATTGAATCGCCTGG
Strand - +
Off-target summary No data {0: 16, 1: 2, 2: 4, 3: 11, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!