ID: 922838255_922838265

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 922838255 922838265
Species Human (GRCh38) Human (GRCh38)
Location 1:228633953-228633975 1:228633975-228633997
Sequence CCGTTTGGCGGGAGCCGTGGCAC CCGGGCGGGCCCGGAGGCCTGGG
Strand - +
Off-target summary No data {0: 18, 1: 0, 2: 3, 3: 36, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!