ID: 922838871_922838884

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 922838871 922838884
Species Human (GRCh38) Human (GRCh38)
Location 1:228636398-228636420 1:228636417-228636439
Sequence CCTGCCCGCCCCTTCCCCCGGTT GGTTTGGAAGGGTGCGACGACGG
Strand - +
Off-target summary No data {0: 18, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!