ID: 922838873_922838884

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 922838873 922838884
Species Human (GRCh38) Human (GRCh38)
Location 1:228636402-228636424 1:228636417-228636439
Sequence CCCGCCCCTTCCCCCGGTTTGGA GGTTTGGAAGGGTGCGACGACGG
Strand - +
Off-target summary {0: 18, 1: 5, 2: 5, 3: 12, 4: 206} {0: 18, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!