ID: 922838881_922838890

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 922838881 922838890
Species Human (GRCh38) Human (GRCh38)
Location 1:228636413-228636435 1:228636446-228636468
Sequence CCCCGGTTTGGAAGGGTGCGACG ATGGGTGAATTGAATCACCTGGG
Strand - +
Off-target summary {0: 17, 1: 0, 2: 0, 3: 2, 4: 14} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!