ID: 922838883_922838891

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922838883 922838891
Species Human (GRCh38) Human (GRCh38)
Location 1:228636415-228636437 1:228636454-228636476
Sequence CCGGTTTGGAAGGGTGCGACGAC ATTGAATCACCTGGGCGTTCCGG
Strand - +
Off-target summary No data {0: 2, 1: 16, 2: 0, 3: 8, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!