ID: 922854322_922854333

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922854322 922854333
Species Human (GRCh38) Human (GRCh38)
Location 1:228761115-228761137 1:228761152-228761174
Sequence CCAAAGAACGTAGGGATTTTCGC TTGTGGGTAGGGCAGGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 132, 4: 1029}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!