ID: 922919298_922919300

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922919298 922919300
Species Human (GRCh38) Human (GRCh38)
Location 1:229288046-229288068 1:229288085-229288107
Sequence CCAAATCATTTCCATAGAACACT CAAACACCTGTAGCTTGCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 198} {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!