ID: 922928120_922928132

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 922928120 922928132
Species Human (GRCh38) Human (GRCh38)
Location 1:229367623-229367645 1:229367673-229367695
Sequence CCGCCTCGGCCTCCCAAAATGCT CTGACAAATGAGGCTTTTGTAGG
Strand - +
Off-target summary {0: 3308, 1: 98747, 2: 190507, 3: 136049, 4: 84666} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!