ID: 922928122_922928133

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 922928122 922928133
Species Human (GRCh38) Human (GRCh38)
Location 1:229367626-229367648 1:229367674-229367696
Sequence CCTCGGCCTCCCAAAATGCTGGG TGACAAATGAGGCTTTTGTAGGG
Strand - +
Off-target summary {0: 4469, 1: 129842, 2: 272674, 3: 216516, 4: 224942} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!