ID: 922928124_922928133

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 922928124 922928133
Species Human (GRCh38) Human (GRCh38)
Location 1:229367632-229367654 1:229367674-229367696
Sequence CCTCCCAAAATGCTGGGATTACA TGACAAATGAGGCTTTTGTAGGG
Strand - +
Off-target summary {0: 13476, 1: 310447, 2: 266634, 3: 201224, 4: 222235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!