ID: 922928126_922928133

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922928126 922928133
Species Human (GRCh38) Human (GRCh38)
Location 1:229367635-229367657 1:229367674-229367696
Sequence CCCAAAATGCTGGGATTACAGGC TGACAAATGAGGCTTTTGTAGGG
Strand - +
Off-target summary {0: 9429, 1: 235524, 2: 277870, 3: 222838, 4: 263838} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!