ID: 923008087_923008094

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 923008087 923008094
Species Human (GRCh38) Human (GRCh38)
Location 1:230067633-230067655 1:230067673-230067695
Sequence CCCTCTCGTGGACGTCGCCCCTC TCGAGTCTTGTCCGGCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 40} {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!