ID: 923022507_923022513

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 923022507 923022513
Species Human (GRCh38) Human (GRCh38)
Location 1:230175652-230175674 1:230175667-230175689
Sequence CCTCCTCCTCACTGTCCTCCCCC CCTCCCCCTCCTTCTCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 30, 3: 384, 4: 3025} {0: 1, 1: 0, 2: 9, 3: 87, 4: 803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!