ID: 923028954_923028961

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 923028954 923028961
Species Human (GRCh38) Human (GRCh38)
Location 1:230231440-230231462 1:230231479-230231501
Sequence CCTATTTCTTTGTTCCTCCCAAC CTGTGTTATTGGACAGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 392} {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!