ID: 923047205_923047209

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 923047205 923047209
Species Human (GRCh38) Human (GRCh38)
Location 1:230364102-230364124 1:230364149-230364171
Sequence CCTTGCTCAATCTCTTTGTTCAC CTTGATTCTCAGCTCTATTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 266} {0: 1, 1: 0, 2: 2, 3: 16, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!