ID: 923055884_923055892

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 923055884 923055892
Species Human (GRCh38) Human (GRCh38)
Location 1:230425899-230425921 1:230425914-230425936
Sequence CCTCCGCGCGCCCCCGCCGCCCT GCCGCCCTCGGCCATGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 155, 4: 1035} {0: 1, 1: 0, 2: 2, 3: 27, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!