ID: 923057573_923057579

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 923057573 923057579
Species Human (GRCh38) Human (GRCh38)
Location 1:230438695-230438717 1:230438718-230438740
Sequence CCTCAGGAGTGCCTGGAGCTGGG TCTTGTGCTCTGCGGTGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!