ID: 923090247_923090251

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 923090247 923090251
Species Human (GRCh38) Human (GRCh38)
Location 1:230735214-230735236 1:230735235-230735257
Sequence CCACTACCTCCCAGAGCATGGAA AAATCTCGCCCCGACTGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 299} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!