ID: 923097297_923097300

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 923097297 923097300
Species Human (GRCh38) Human (GRCh38)
Location 1:230785588-230785610 1:230785602-230785624
Sequence CCCTTCACCTTCTGCAATAATTG CAATAATTGTAAGTTTCCTGAGG
Strand - +
Off-target summary {0: 4, 1: 107, 2: 1520, 3: 2780, 4: 5548} {0: 7, 1: 603, 2: 6974, 3: 8695, 4: 6576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!