ID: 923097297_923097302

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 923097297 923097302
Species Human (GRCh38) Human (GRCh38)
Location 1:230785588-230785610 1:230785622-230785644
Sequence CCCTTCACCTTCTGCAATAATTG AGGCCTCCTTAGAAGCAGAACGG
Strand - +
Off-target summary {0: 4, 1: 107, 2: 1520, 3: 2780, 4: 5548} {0: 1, 1: 0, 2: 1, 3: 18, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!