ID: 923127589_923127593

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 923127589 923127593
Species Human (GRCh38) Human (GRCh38)
Location 1:231046074-231046096 1:231046113-231046135
Sequence CCACCACTCTTGTAGCAGGACAA ATCAGACACCGGGTTAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!