ID: 923128355_923128363

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 923128355 923128363
Species Human (GRCh38) Human (GRCh38)
Location 1:231053063-231053085 1:231053102-231053124
Sequence CCCTGCAACTTCTGCCTCCCAGG GCCCCAGCCTCTCTAGTAGCTGG
Strand - +
Off-target summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!