|
Left Crispr |
Right Crispr |
| Crispr ID |
923141982 |
923141989 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:231168172-231168194
|
1:231168215-231168237
|
| Sequence |
CCAGGCTGGTCTCAATTGAACTC |
TACCTTGGCCTCCCAAAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 23, 3: 120, 4: 522} |
{0: 1, 1: 13, 2: 138, 3: 949, 4: 2481} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|