ID: 923149065_923149074

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 923149065 923149074
Species Human (GRCh38) Human (GRCh38)
Location 1:231217791-231217813 1:231217826-231217848
Sequence CCTAACCCCTTTGAGGGAGCAGC AGAGAAGTGGAAAGTGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120} {0: 1, 1: 0, 2: 8, 3: 101, 4: 743}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!