ID: 923151653_923151659

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 923151653 923151659
Species Human (GRCh38) Human (GRCh38)
Location 1:231238916-231238938 1:231238933-231238955
Sequence CCACTTCTACTTGTTCCCTATTG CTATTGTTCTTTAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 233} {0: 1, 1: 0, 2: 2, 3: 14, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!