ID: 923187574_923187585

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 923187574 923187585
Species Human (GRCh38) Human (GRCh38)
Location 1:231588877-231588899 1:231588920-231588942
Sequence CCCTGTGTCCCCTACAACATCTG GTTAAAACGAGGCCGGAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 243} {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!