ID: 923208819_923208820

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 923208819 923208820
Species Human (GRCh38) Human (GRCh38)
Location 1:231784574-231784596 1:231784600-231784622
Sequence CCTGATTTTGGTCAGATTACTCT ATATTTTCTTACTATAATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161} {0: 1, 1: 0, 2: 1, 3: 35, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!