ID: 923209034_923209035

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 923209034 923209035
Species Human (GRCh38) Human (GRCh38)
Location 1:231786720-231786742 1:231786739-231786761
Sequence CCATGGTAGGTTTTATATGGGGA GGGACCTAGCCTGTATGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116} {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!