ID: 923211602_923211608

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 923211602 923211608
Species Human (GRCh38) Human (GRCh38)
Location 1:231808654-231808676 1:231808676-231808698
Sequence CCAATGCCTAGTTGTCTGACCTG GTGACCAGGGGCTCCTCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 137} {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!