ID: 923212160_923212162

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 923212160 923212162
Species Human (GRCh38) Human (GRCh38)
Location 1:231813329-231813351 1:231813348-231813370
Sequence CCAGAAGACATGTTGGGACTTCA TTCATAAGCACAGCCTAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148} {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!