ID: 923228005_923228009

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 923228005 923228009
Species Human (GRCh38) Human (GRCh38)
Location 1:231957130-231957152 1:231957168-231957190
Sequence CCGCTTGATTGGACCTGGGTTGT TTTTCTCCCTATGGAACATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90} {0: 1, 1: 0, 2: 5, 3: 54, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!