ID: 923231048_923231051

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 923231048 923231051
Species Human (GRCh38) Human (GRCh38)
Location 1:231986733-231986755 1:231986765-231986787
Sequence CCTGTCACTTCACTTGGTGTATC TAATGTGACCACAGTGCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!