ID: 923234620_923234625

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 923234620 923234625
Species Human (GRCh38) Human (GRCh38)
Location 1:232020514-232020536 1:232020558-232020580
Sequence CCTGAAGGAGGCAGATCTTTGTA AACAAGATGGTGTTAAGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 153} {0: 1, 1: 0, 2: 1, 3: 22, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!